Skip to main content

Table 1 List of oligonucleotide sequences used for real-time qPCR

From: Caspase-3, myogenic transcription factors and cell cycle inhibitors are regulated by leukemia inhibitory factor to mediate inhibition of myogenic differentiation

Gene name Forward (5'-3') Reverse (5'-3')
c-fos atgggctctcctgtcaacac tgtcaccgtggggataaagt
cyclophilinA ggccgatgacgagccc tgtctttggaactttgtctgcaa
gp130 catagtcgtgcctgtgtgct gtgaccactgggcaatatga
LIF caagaatcaactggcacagc agtggggttcaggaccttct
LIFR agaagaactggctcccattg ggatgtcgtcccatttcact
MyoD tacagtggcgactcagatgc tagtaggcggtgtcgtagcc
Myogenin agtgaatgcaactcccacag acgatggacgtaagggagtg
p21 gcagaccagcctgacagattc ttcagggttttctcttgcagaag