Skip to main content

Table 1 Primers for PCR

From: Direct reprogramming of urine-derived cells with inducible MyoD for modeling human muscle disease

ACTN2 F: CTAAAATGTTGGATGCTGAAGACA
R: CAGCAATATCCGACACCATCTTGC
DES F: AAGGGCACTAACGATTCCCT
R: CATCCCGTGTCTCGATGGTC
DMD (exons 1 to 3) F: TCCTGGCATCAGTTACTGTGTT
R: TATGCTGCTTCCCAAACTTAGAA
DMD (exons 42 to 50/51) F: CAATGCTCCTGACCTCTGTG
R: GAGTAGGAGAGGCTCCAATA
DMD (exons 44 to 48) F: GAACAGTTTCTCAGAAAGAC
R: GCAGCAGATGATTTAACTGC
GAPDH F: ACCACAGTCCATGCCATCAC
R: CCACCACCCTGTTGCTGTAG
MYH2 F: GAGGCTGACTCGTCCTGCTTTA
R: GACTGATTCTCTCGGTCAGTCA
MYH3 F: CTTGTGGGCGGAGGTCTGG
R: GCCACTTGTAGGGGTTGACA
MYOG F: ACCCAGGGGATCATCTGCTCA
R: CACTGGCATCGGGAAGAGAC
SGCG F: TCTAAGATGGTGCGTGAGCAG
R: GCCACAGACAGGTACAGCTT