Skip to main content

Table 1 PCR primers

From: VAChT overexpression increases acetylcholine at the synaptic cleft and accelerates aging of neuromuscular junctions

Gene Fw (5′–3′) Rv (5′–3′)
GAPDH CCCACTCTTCCACCTTCGATG GTCCACCACCCTGTTGCTGTAG
AChE CTACACCACGGAGGAGAGGA CTGGTTCTTCCAGTGCACCA
AChRγ GCTCAGCTGCAAGTTGATCTC CCTCCTGCTCCATCTCTGTC
AChRε GCTGTGTGGATGCTGTGAAC GCTGCCCAAAAACAGACATT
MuSK CCACACTGCGTGGAATGAGC CTCTGCAAATGGGCATGGG
LRP4 GGCAAAAAGCAGGAACTTGT TCTACCCAGTGGCCAGAACT
Rapsyn GTGCCATGGAGTGTTGTGAG CGGTTTCCGATCTCAGTCAT
Dok7 GGGTACTGGGCTGGAGTCTT TCGGACGATGCAGTCAAACA
CDK5 GCCAGACTATAAGCCCTACCC GTCAGAGAAGTAGGGGTGCT
MyHC2A GAGTGAGCAGAAGCGGAATGCT GCGGAACTTGGATAGATTTGTG
MyHC2B CACCTGGACGATGCTCTCAGA GCTCTTGCTCGGCCACTCT
MyHC2X GCTAGTAACATGGAGGTCA TAAGGCACTCTTGGCCTTTATC
Myogenin GCACTGGAGTTCGGTCCCA GTGATGCTGTCCACGATGGA
Foxo1 GAGTTAGTGAGCAGGCTACATTT TTGGACTGCTCCTCAGTTCC
Atrogin-1 GCAGCAGCTGAATAGCATCCA GGTGATCGTGAGGCCTTTGAA
Agrin-8 CTTTGATGGGCGGACCTACA CGCTTTCTCAGCTGGGATCT
Agrin-11 CAGTGGGGGACCTAGAAACAC TTTCAGGGCTCTCAGTCACAG
Agrin-19 CTTTGATGGGCGGACCTACA AGTTTCAGGGGCTGGGATCT
Chat CCTGGATGGTCCAGGCACT GTCATACCAACGATTCGCTCC
VAChT GAGAGTACTTTGCCTGGGAGGA GGCCACAGTAAGACCTCCCTTG