Skip to main content

Table 1 Primer design for the RT-PCR assay

From: Low-intensity pulsed ultrasound prevents muscle atrophy induced by type 1 diabetes in rats

Gene Primer PCR product length (bp) Sequence 5′ to 3′ Tm (°C)
MSTN F 423 GATTATCACGCTACCACG 58.9
R ATTCAGCCCATCTTCTCC
ActRIIB F 163 GCAGTCGTGGCAGAGTGAGCG 51.7
R CTTGAGGTAATCCGTGAGGGAGC
Akt F 269 TAGGCATCCCTTCCTTACAG 55.8
R GCCCGAAGTCCGTTATCT
FoxO1 F 459 TCAAGGATAAGGGCGACAG 54.4
R GTGGATACACCAGGGAATG
mTOR F 368 CTGGCTTCCAACCCTAAA 53.5
R TCTCCAAATCCCACTCCC
GLUT4 F 545 GTC ATC AAC GCC CCA CAG 56.8
R TCA GGA CAG AAG GGC AAC AG
GAPDH F 292 CGACTGTTAGAACTCCCTCA 57.4
R CATTGGGGGTAGGAACAC
  1. F forward, R reverse