Skip to main content

Table 1 Primer used for real-time PCR

From: HDAC4 preserves skeletal muscle structure following long-term denervation by mediating distinct cellular responses

Gene Forward Reverse
Atg7 GCCTAACACAGATGCTGCAA TGCTCTTAAACCGAGGCTGT
Gabarapl1 GTGCCGGTCATCGTGGA TCCTCGTGGTTGTCCTCA
p62 CCCAGTGTCTTGGCATTCTT AGGGAAAGCAGAGGAAGCTC
Gsr1 AAT TGG CGT GTT ATT AAG GAA AAG C TCT ATA TGG GAC TTG GTG AGA TTG T
Gstp1 ATG ACT ATG TGA AGG CAC TG AGG TTC ACG TAC TCA GGG GA
NQO1 CAT TCT GAA AGG CTG GTT TGA CTA GCT TTG ATC TGG TTG TCA G
Catalase CCT CCT CGT TCA AGA TGT GGT TTT C CCT CCT CGT TCA AGA TGT GGT TTT C
Gapdh ACCCAGAAGACTGTGGATGG CACATTGGGGGTAGGAACAC