Skip to main content

Table 1 Primers for RT-q-PCR amplifications

From: Deletion of the microtubule-associated protein 6 (MAP6) results in skeletal muscle dysfunction

Mouse gene Forward (5′–3′) Reverse (5′–3′)
β-actin GACAGGATGCAGAAGGAGATTACTG CTCAGGAGGAGCAATGATCTTGAT
Chrng AGCCTCCCCAGCCATCCAGG GGCCCACCAGCAACCACTCC
Map6_ex1-2 CCCTCAACAGGCAAATCC TCTCATGAACCATCTTGTCATC
Musk ATCACCACGCCTCTTGAAAC TGTCTTCCACGCTCAGAATG
Myogenin CTTGCTCAGCTCCCTCAAC TGGGAGTTGCATTCACTGG
Runx1 GAAGAACCAGGTAGCGAGATTC GTAAAGACGGTGATGGTCAGAG