Fig. 2

Segregation analysis and results of MYPN cDNA analysis. a MYPN DNA Sanger sequencing. Patients II.2 and II.3 were homozygous for p.Ser769LeufsTer92 in exon 11. Unaffected consanguineous parents were heterozygous (I.1, I.2), and unaffected brother did not show the variant (II.1). b RT-PCR on the MYPN coding sequencing using primers pairs: MYPN_c.1879F TCTTTCCAGGAGAGGTTCAACG and MYPN_c.2666R TTCCCCAAGTCTCGAATCACTG. The RT-PCR generated a fragment from exon 10 to exon 12. The patient mRNA transcript level was similar to the healthy control. c Sanger sequence of amplified region on the patient and control