Skip to main content

Table 1 The list of PCR primers

From: Exercise enhances mitochondrial fission and mitophagy to improve myopathy following critical limb ischemia in elderly mice via the PGC1a/FNDC5/irisin pathway

Gene name Sequence 5′–3′ (forward) Sequence 5′–3′ (reverse)
PGC1a tat gga gtg aca tag agt gtg ct ccacttcaatcc acc cag aaa g
FNDC5 ttgccatctctcagc aga aga ggcctgcacatggac gat a
DRP1 act gat tcaatccgt gat gag t gta acc tat tcagggtcc tag c
FIS1 gacatccgc aga ggcatc gtg cag ctccttggcctggttgtt c
LC3B cgtcctggacaagaccaagtt c gcaagcgccgtctgattatc
PINK1 gca gca gtc agc agc cac tc agc ctc aca ctc cag gtt agc c
PARKIN aag gaa gtg gtt gct aag cga cag atg act tct cct ccg tgg tct ctg
GAPDH ggttgtctcctgcgactt ca tggtccagggtttct tac tcc