Skip to main content

Table 1 List of RT-qPCR primers

From: Dnmt3b regulates DUX4 expression in a tissue-dependent manner in transgenic D4Z4 mice

Gene Forward primer Reverse primer
CD19 GGCTTCTACCTGTGCCAGAA CTGACGTCTGAAGCATTCCA
Cxcl12 ACCAGTCAGCCTGAGCTACC TAATTTCGGGTCAATGCACA
Dnmt3b CGCAGGAAAGATTGGAACAT CGTTGCAATTCCATCAAACA
DUX4 CCCAGGTACCAGCAGACC TCCAGGAGATGTAACTCTAATCCA
Gapdh TCCATGACAACTTTGGCATTG TCACGCCACAGCTTTCCA
IFNγ CTTCTTCAGCAACAGCAAGG TGAGCTCATTGAATGCTTGG
IL-1β CTTTCCCGTGGACCTTCC CATCATCATCCCATGAGTCAC
IL-6 TGTGCAATGGCAATTCTGAT CTCTGAAGGACTCTGGCTTTG
Mef2c TCCATCAGCCATTTCAACAA GTTACAGAGCCGAGGTGGAG
Podoplanin ATTGTGACCCCAGGTACAGG GCTGAGGTGGACAGTTCCTC
Rpl13a TGCTGCTCTCAAGGTTGTTC TTCTCCTCCAGAGTGGCTGT
TNFα CGAGTGACAAGCCTGTAGCC CTTTGAGATCCATGCCGTTG
Wfdc3 CTTCCATGTCAGGAGCTGTG ACCAGGATTCTGGGACATTG