Skip to main content

Table 1 The sequences of primers used for the determination of gene expression by qRT-PCR

From: Simvastatin does not alleviate muscle pathology in a mouse model of Duchenne muscular dystrophy

Gene Sequence 5’-3’
Ang 1 F: CAGTGGCTGCAAAAACTTGA
R: TGGGCCATCTCCGACTTCAT
Col1a1 F: CGATCCAGTACTCTCCGCTCTTCC
R: ACTACCGGGCCGATGATGCTAACG
Cxcl12 F: CCTTCAGATTGTTGCACGGCT
R: CCCACCACTGCCCTTGCATC
Eef2 F: AGAACATATTATTGCTGGCG
R: AACAGGGTCAGATTTCTTG
Hmox1 F: CCTCACTGGCAGGAAATCATC
R: CCTCGTGGAGACGCTTTACATA
Kdr F: CGGCCAAGTGATTGAGGCAG
R: ATGAGGGCTCGATGCTCGCT
Mmp11 F: CAGATTTGGTTCTTCCAAGG
R: AGATCTTGTTCTTCTCAGGAC
Myh3 F: TCTAGCCGGATGGTGGTCC
R: GAATTGTCAGGAGCCACGAA
Spp1 F: CCATCTCAGAAGCAGAATCTCCTT
R: GGTCATGGCTTTCATTGGAATT
Tgfb1 F: GGATACCAACTATTGCTTGAG
R: TGTCCAGGCTCCAAATATAG
Vegfa F: ATGCGGATCAAACCTCACCAA
R: TTAACTCAAGCTGCCTCGCCT