Skip to main content

Table 3 The list of primers used for quantitative RT_PCR analysis.

From: Deregulation of the ubiquitin-proteasome system is the predominant molecular pathology in OPMD animal models and patients

Genes Probe FW Primer Sequence RV Primer Sequence
Arih1 6900025 GAGAAGGATGGCGGTTGTAA ATCTCTTGCTGCCTTTGCAT
Arih2 2810025 AGCCTAACTCCCCCTTGGTA ACCACTGAGGGTGCAAAAAC
Ate1 6940722 CAAAGTGATTCTACTGTGGCTGA ACGAAAATCTCCAATGCAGTC
Cul7 3360114 CGGGACTATGCGGTGATACT GTGGGTTCGTCTGTGGTCTT
Psme3 2810537 GCGAAGGTCAAACCCATAGA GAAAGTGATGCATCCCAGGT
Rbx1 2340047 TTGAGGCCAGCCTACAGAGT AGGAAAACTCCCCTGAAGGA
Skp1a 2450102 TGCAGCTGGGCTCTCTTAAT GTTTCTCCACCTGGGAACAA
Uchl1 1230066 CCTGTCCCTTCAGTTCCTCA GATTAACCCCGAGATGCTGA
Huwe1 106840041 GCTGCATTGAGACTTGAAACC TCCACAACACAGATGCCAAT
Tbl1x 6400524 ATTTTCCCCCTCCCCTAATC GAGCCTGTTCTGGATGGAAA
Ube4b 3610154 GCTGGAGTGGATCAGGACTC TGGTAAGGTCAAACCCCAAA
Ube2o 2190040 CGGTGAGCACATTACAGCTC GCATCATGCTTTGGCTTTTT
Usp47 100940601 GAATGCTTGTAAAGTCCCGTTT CTAGCACGCTCTGCAATGAA
Ppp2cb 5570593 ACTGCTACCGTTGTGGGAAC AGGTCCTGGGGAGGAATTTA
Ube3b 6380458 GCCTGCACAGGTAACACAGA ACCAGGAGCTGCTGAGATGT
Fbxo32 110037 GGGAGGCAATGTCTGTGTTT AAGAGGTGCAGGGACTGAGA
Trim63 1740164 CGACCGAGTGCAGACGATCATCTC GTGTCAAACTTCTGACTCAGC
Ubr5 1780605 GCTGCCTTTGTGGAAAGTGT TTGCAGCCAACCACAAATAA
Asb11 2060487 TTGTGCTGAACAAGCTCCTG GAGGGTCCTGAATCATCCAA
mHPRT - CGTCGTGATTAGCGATGATG TTTTCCAAATCCTCGGCATA