Skip to main content

Table 1 Primers for PCR amplification

From: Distinct roles for Ste20-like kinase SLK in muscle function and regeneration

Primer Primer Sequence 5′→3′
SLK Forward GAGCAGGTCAGCGAGTCCAATAG
  Reverse CTCTCAGGCGGTTAGTGTGCTCTT