Skip to main content

Table 1 Sequences of primers used for quantitative PCR

From: The ERG1a potassium channel increases basal intracellular calcium concentration and calpain activity in skeletal muscle cells

Primer name (mouse)Primer sequence 5′–3′Size (bp)aTm (°C)GC (%)Amplicon size (bp)a
Merg1a forwardcctcgacaccatcatccgca2059.655.0145
Merg1a reverseaggaaatcgcaggtgcaggg2060.360.0 
18S subunit forwardcgccgctagaggtgaaattct2157.252.4101
18S subunit reverseagaacgaaagtcggaggttc2057.052.4 
Calpain 1 forwardgctaccgtttgtctagcgtc2058.7355.098
Calpain 1 reversetaactcctctgtcatcctctggt2359.9947.83 
Calpain 2 forwardttttgtgcggtgtttggtcc2059.8350.0107
Calpain 2 reverseaactcagccacgaagcaagg2060.8955.0 
Calpain 3 forwardttcacaggaggggtgacaga2060.1155.0122
Calpain 3 reversettcgtgccatcgtcaatggag2161.0152.38 
Calpastatin forwardgccttggatgacctgataga2053.850.0115
Calpastatin reversegtgcctcaaggtaggtagaa2053.750.0 
  1. abp base pair